СОВРЕМЕННЫЕ КРИТЕРИИ ПРОГНОЗА В КОМПЛЕКСНОЙ ДИАГНОСТИКЕ ПЕРВИЧНЫХ ОПУХОЛЕЙ КОСТЕЙ (клинико-морфологическое исследование) (21.03.2011)

Автор: Булычева Ирина Владиславовна

EMA Mкл Dako 1/200

Fli-1 Пкл Santa Cruz 1/50

HBA71 (CD99/MIC-2) Mкл Dako 1/50

HNK (CD57) (LEU-7) Mкл ATCC 10 мкг/мл

Ki-67 (MIB-1) Mкл Dako 1/50

LCA (CD45) Mкл Dako 1/50

Myogenin Пкл Santa Cruz 1/100

Myo-D1 Mкл Novocastra 1/20

Ocludin Пкл Zymed 1/50

p16 Mкл Santa Cruz 1/100

p53 (DO-7) Mкл Dako 1/50

S-100 Пкл Menarini 1/200

T cells (CD45RO) Mкл Dako 1/200

Vimentin Mкл Novocastra 1/200

ZO-1 Пкл Zymed 1/50

Применяли систему детекции LSAB+Immuno-detection («Dako», Дания), комплекс энзим-антиген выявлялся с помощью диаминобензидина (DAB, «Dako», Дания).

Молекулярно-генетические методы исследования. Все образцы 17 опухолей фиксировали в формалине, заключали в парафин, микротомировали и депарафинировали. Комбинировали 17 образцов сарком в тканевую матрицу, состоящую из дубликатов столбиков в 1 мм с использованием ручного тканевого инструмента (Beecher Instruments, Sun Prairie, WI, USA). Все образцы и блок тканевой матрицы окрашивали гематоксилином и эозином, препараты просматривали три независимых патологоанатома и оценивали по классификации ВОЗ (Rds Ch.D.M.Fletcher et al., 2002).

Пробы с разрывом (break-apart) и FISH. В исследовании применяли коммерческие LSI EWSR1 разрывные пробы с двойным окрашиванием (Vysis, Downers Grove, IL) для гибридизации в положение 22q12. Использованные пробы - комбинация двух ДНК FISH проб. Первая проба около 1100 kb проявляется зеленым свечением. Она располагается на расстоянии от EWS гена. Вторая проба в оранжевом спектре располагается проксимально от EWS гена, измеряется около 500 kb. Метки разъединены промежутком в 7 kb в пределах EWS гена. Для предварительной обработки слайдов добавляли смесь предподготовки (1 мл пробы, 7 мл LSI гидролизирующего буфера и 2 мл деионизированной воды). Второй коммерческий состав состоял из пробы ДНК (Q-BIOgene, Irvine, CA), применяемой для FISH анализа, включавшего р16INK4A(СDKN2A) генную специфическую пробу, меченную родамином красным и ABL(9Q34) - специфическую пробу, меченную d Green для выявления хромосом. Определяли FISH критерии для клеток опухоли с нормальным и удаленным р16INК4А геном в положении 9p21.

Молекулярная биология. Trizol метод использовали для выделения РНК из 5-10 толстых (5 мкн) парафиновых срезов ткани, фиксированной в формалине. ПЦР с обратной транскриптазой применяли в одном тубе с Qiagen OneSep RT-PCR Kit c Q раствором. Обратную транскрипцию проводили при температуре 50оС 30 мин. Полимераза активизировалась при 95оС 15 мин с последующими 40 циклами денатурации при 94оС 30 секунд, прокаливая 30 сек. при 67оС с увеличением температуры до 72оС на 30 секунд с окончательной температурой 72оС на 10 мин. Праймер вперед: TCCTACAGCCAAGCTCCAAGTCAATA; праймер в обратную сторону: ATTGCCCCAAGCTCCCTTCTGAC. Продукт реакции ПЦР визуализировали на 2% агар геле, окрашенном этидий бромидом.

Статистический анализ результатов исследования. При выборе статистических процедур учитывали требования Международного конгресса по гармонизации GСP “Статистические принципы для клинических исследований” (ICH Guidelines // Good Clin.Pract.J.-1998.-Vol.5, №4.-р.27-37).

Результаты собственных исследований

Костеобразующие опухоли

Остеоидная остеома – доброкачественная, продуцирующая остеоид опухоль, характеризующаяся малыми размерами (< 2 см), ограниченным ростом и непропорционально размерам первичного новообразования, резко выраженным болевым синдромом. Исследовано 18 случаев остеоидной остеомы.

Рентгенологическая картина. На обзорных рентгенограммах очаг поражения характеризуется утолщением и уплотнением кортикального слоя кости вокруг небольшого литического гнезда.

Макроскопическая картина. Остеоидная остеома выглядит как маленький, красноватый, кортикально расположенный, крупнозернистый очажок четко отграниченный от желтовато-белой склерозированной окружающей кости.

Гистологическая картина. Опухоль представлена центральным ядром из соединительной ткани, богатой сосудами с обилием продуцирующих остеоид дифференциованных остеобластов, являющихся основным диагностическим критерием, в структуре опухоли встречаются остеокласты.

Остеоид в ядре остеоидной остеомы может располагаться пластами, но чаще микротрабекулами, окруженными остеобластами с «пухлыми» ядрами, что помогает отличить остеоидную остеому и остеобластому от остеосаркомы. Отсутствие ядерного полиморфизма также свидетельствует в пользу доброкачественной, остеоид продуцирующей опухоли.

Остеобластома (оссифицирующаяся гигантоклеточная опухоль, гигантская остеоидная остеома) - доброкачественная, остеоид продуцирующая опухоль, сходная по строению с остеоидной остеомой, формирующая мелкие спикулы волокнистой кости, окруженные остеобластами, обладает неограниченным потенциалом роста. Исследовано 12 случаев остеобластомы различной локализации.

Рентгенологическая картина остеобластомы представляет литический или смешанный, четко очерченный округлый или овальный дефект целостности кости с периостальной реакцией и зоной реактивного костеобразования.

Макроскопическая картина. Остеобластома хорошо кровоснабжается, поэтому ее поверхность макроскопически имеет ярко красный или красно-коричневый цвет, часто с подобием «песчаной крошки» вследствие продукции мелких костных включений. Опухоль окружена скорлупой или зоной реактивного остеогенеза, обладает оппозиционным характером роста. Инфильтративный рост не характерен для остеобластомы. Возможно образование вторичной аневризмальной кисты.

Гистологическая характеристика. Гистологическое строение остеобластомы полностью повторяет остеоидную остеому. Структура опухоли складывается из хаотически расположенных спикул или трабекул волокнистой кости, выстланных рядом остеобластов. Характерна высокая степень васкуляризации опухолевого узла с капиллярами, наполненными эпитроцитами. Могут встречаться физиологические митозы.

В редких случаях, в структуре опухоли встречаются островки гиалинового хряща, формирующего костные микромозоли. При формировании островков или агрегатов из спикул волокнистой кости необходимо проводить дифференциальный диагноз с остеосаркомой.

Остеосаркома (синонимы: центральная остеосаркома, остеофибросаркома, остеохондросаркома, медуллярная остеосаркома) - злокачественная опухоль, при которой новообразованная кость или остеоид продуцируются непосредственно самими опухолевыми клетками. Среди всех сарком кости, остеосаркома встречается наиболее часто и локализуется в длинных костях скелета.

Рентгенологическая картина. Типичной картиной является наличие очага смешанной деструкции кости с разрушением кортикальной пластинки и формированием мягкотканного компонента опухоли. В процессе роста опухоли, периост приподнимается или отслаивается от коркового слоя, это вызывает новое костеобразование, обычно проксимальнее основного узла, данное явление получило название козырька Кодмана. Зона поражения на рентгеновском снимке имеет различную плотность, а характер матрикса часто облаковидный. КТ и МРТ могут играть важную роль в определении распространенности опухолевого процесса. Радионуклидное сканирование скелета выявляет «skip» метастазы, многоузловые опухоли, системное поражение. В ряде клиник принято использовать артериографию, так как остеосаркомы - гиперваскуляризованные опухоли.

Классификация остеосарком. Выделяют центральную классическую остеосаркому и ее основныe гистологические варианты: остеобластический, хондробластический, фибробластический.

Следует выделять особые варианты остеосарком: телангиэктатическую, мелкоклеточную, высокодифференцированную центральную остеосаркому, вторичную, паростальную, периостальную и поверхностную низкодифференцированную остеосаркому. В работе представлено 87 остеосарком, 41 опухоль отнесена к центральному классическому варианту. Опухоль выявлена преимущественно у лиц мужского пола, а в 92% наблюдали поражение метафизов трубчатых костей конечностей.

Макроскопическая картина при классической остеосаркоме представлена крупным метафизарным узлом, расположенным центрально или эксцентрично. По консистенции опухолевая ткань может быть очень плотной или содержать хрящ, кистозные изменения не характерны. Миксоматоз сторомы узла и кистообразование наблюдали после проведения успешных курсов химиотерапии.

Гистологически остеосаркома может быть упрощенно охарактеризована как веретеноклеточная опухоль. Однако только веретеноклеточного компонента недостаточно, чтобы описать микроскопическое строение остеосаркомы. Необходимым минимумом являются два компонента: элементы саркомы и непосредственная продукция остеоида опухолевыми клетками.

В типичных случаях остеоид, окрашенный в розовый цвет, формирует анастомозирующие сплетения, между которыми находятся опухолевые клетки, вся структура может напоминать «кружево». Только при наличии остеоида с опухолевыми клетками, можно с уверенностью поставить диагноз остеосаркомы. При хондробластических вариантах остеосаркомы, основную массу опухоли составляют дольки хрящевой ткани. Данные структуры обладают зональностью, характерно увеличение количества вытянутых клеток по периферии долек, существует переход от хрящевой центральной зоны дольки к периферическим ее отделам, где преобладают вытянутые клетки. Преобладание веретеноклеточного компонента предполагает диагноз фибробластического варианта остеосаркомы.

Существуют особые гистологические формы остеосаркомы: склерозирующий тип остеосаркомы, остеосаркома, напоминающая остеобластому, хондромиксоидную фиброму, хондробластому, ЗФГ. Отдельными гистологическими вариантами описаны остеосаркома богатая гигантскими клетками и эпителиоидная остеосаркома [рис. 9]


загрузка...